Review



e coli dhfr  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Addgene inc e coli dhfr
    E Coli Dhfr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+dhfr+dd+yfp/pBMN+YFP-DHFR(DD)+(Plasmid+%2329326)/pmc12802846-165-0-6
    Average 94 stars, based on 8 article reviews
    e coli dhfr - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: A convenient method to pre-screen candidate guide RNAs for CRISPR/Cas9 gene editing by NHEJ-mediated integration of a ‘self-cleaving’ GFP-expression plasmid
    Article Snippet: The self-cleaving plasmid containing a puromycin cassette, pSc1-puro, was prepared by PCR-amplifying the puromycin cassette (hPGK-Puro-SV40polyA) from pLKO.1puro plasmid (Addgene #8453, 4) using Q5 polymerase and primers Sc1purogibson-PCR-fwd and Sc1purogibson-PCR-rev and was integrated into Esp3I-linearized pSc1 vector by using Gibson Assembly Master Mix. previously made construct (pDD-GFP, sequence available in Supplementary Data) the GFP cassette with an N-terminally fused ecDHFR-DD was cloned to pSc1 plasmid between NheI and Bsp1407I restriction enzyme sites. .. The pDD-GFP plasmid was originally created from pBMN DHFR(DD)-YFP (Addgene #29325 5) . ..

    Article Title: Sensor systems for target ligands and uses thereof
    Article Snippet: .. Miscellaneous Plasmids—pCAG-GFP (Addgene plasmid 11150) (Matsuda and Cepko, 2004), pCAG-YFP (Addgene plasmid 11180) (Matsuda and Cepko, 2004), pCAG-DsRed (Addgene 11151) (Matsuda and Cepko, 2004). pRho-GFP-IRES-AP (referred to as Rho-GFP in main text) (Emerson and Cepko, 2011). pCAG-nlacZ (Cepko lab, Harvard Medical School), pCAGEN (Addgene plasmid 11160) (Matsuda and Cepko, 2004). pCALNL-DsRed (Addgene plasmid 13769) (Matsuda and Cepko, 2004). pCAFNF-DsRed (Addgene plasmid 13771) (Matsuda and Cepko, 2004). pCAG-GAPDH-AU1 (Emerson and Cepko, 2011). pBMN DHFR(DD)-YFP (Addgene plasmid #29325) (Iwamoto et al., 2010). pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230) (Cong et al., 2013). pRL-TK (Promega, 4E2241). .. Plasmid construction—All DNA constructs were generated with standard techniques: pBMN-GBP1-TagBFP—A GBP1-TagBFP construct inserted into a BamHI/NotI digested pBMN-DHFR(DD)-YFP vector (Addgene plasmid 29325), replacing the DHFR(DD)-YFP insert and generating pBMN-GBP1-TagBFP vector.

    Article Title: Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation
    Article Snippet: .. Destabilized dCas9 activator was generated by PCR cloning the DHFR(DD) from pBMN DHFR(DD)-YFP (Addgene plasmid: 29352) and inserting it Nterminally in fusion with the dCas9 in the PB-CAG-dCas9VP192-GFP-IRES-Neo. ..

    Article Title: Selectable one-step PCR-mediated integration of a degron for rapid depletion of endogenous human proteins
    Article Snippet: .. Each gRNA was inserted into pX330 as described by Ran et al. ( 25 ). pAc5 HA3-eDHFR-T2A-puro was derived from pAc5gRNA Cas9 ( 26 ) by replacing the Eco RI- Hin dIII fragment encoding Cas9 with a PCR fragment encoding HA3-eDHFR amplified from pBMN DHFR(DD)-YFP ( 22 ) (Addgene plasmid #29325) with primers HA3-eDHFRfw and eDHFRrev (see Supplementary Material ). ..

    Article Title: Engineering receptors in the secretory pathway for orthogonal signalling control
    Article Snippet: .. The resulting PCR product was cloned EcoRI/HindIII into linearized pMMH37 by Gibson assembly. (PhPGK-SrcMS-TCS-tTA-pAbGH) This work pMMH202 Constitutive mammalian expression vector encoding PhPGK-driven ecDHFR(DD)-TCS-tTA expression. ecDHFR(DD) was PCR amplified from pBMN DHFR(DD)-YFP (Addgene no. 29325) using the primers: 5`- ggtatagggagaccgaattcatgatcagtctgattgcggcgttagcggtagattac and 5`- gttaatcactttacttttatctaatctggaactagttccacctccaccggactgaaagtacaggttttcaga tccacctccaccccgctccagaatctcaaagcaatagctgtgagagtt. ..

    Article Title: A drug-tunable Flt23k gene therapy for controlled intervention in retinal neovascularization.
    Article Snippet: .. The DHFR(DD) DNA sequence was based on pBMN-DHFR(DD)-YFP (a gift from Dr. Thomas Wandless at the Stanford University, USA; Addgene plasmid #29325). ..

    Generated:

    Article Title: Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation
    Article Snippet: .. Destabilized dCas9 activator was generated by PCR cloning the DHFR(DD) from pBMN DHFR(DD)-YFP (Addgene plasmid: 29352) and inserting it Nterminally in fusion with the dCas9 in the PB-CAG-dCas9VP192-GFP-IRES-Neo. ..

    Polymerase Chain Reaction:

    Article Title: Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation
    Article Snippet: .. Destabilized dCas9 activator was generated by PCR cloning the DHFR(DD) from pBMN DHFR(DD)-YFP (Addgene plasmid: 29352) and inserting it Nterminally in fusion with the dCas9 in the PB-CAG-dCas9VP192-GFP-IRES-Neo. ..

    Article Title: Selectable one-step PCR-mediated integration of a degron for rapid depletion of endogenous human proteins
    Article Snippet: .. Each gRNA was inserted into pX330 as described by Ran et al. ( 25 ). pAc5 HA3-eDHFR-T2A-puro was derived from pAc5gRNA Cas9 ( 26 ) by replacing the Eco RI- Hin dIII fragment encoding Cas9 with a PCR fragment encoding HA3-eDHFR amplified from pBMN DHFR(DD)-YFP ( 22 ) (Addgene plasmid #29325) with primers HA3-eDHFRfw and eDHFRrev (see Supplementary Material ). ..

    Article Title: Engineering receptors in the secretory pathway for orthogonal signalling control
    Article Snippet: .. The resulting PCR product was cloned EcoRI/HindIII into linearized pMMH37 by Gibson assembly. (PhPGK-SrcMS-TCS-tTA-pAbGH) This work pMMH202 Constitutive mammalian expression vector encoding PhPGK-driven ecDHFR(DD)-TCS-tTA expression. ecDHFR(DD) was PCR amplified from pBMN DHFR(DD)-YFP (Addgene no. 29325) using the primers: 5`- ggtatagggagaccgaattcatgatcagtctgattgcggcgttagcggtagattac and 5`- gttaatcactttacttttatctaatctggaactagttccacctccaccggactgaaagtacaggttttcaga tccacctccaccccgctccagaatctcaaagcaatagctgtgagagtt. ..

    Article Title: Achieving tight control of a photoactivatable Cre recombinase gene switch: new design strategies and functional characterization in mammalian cells and rodent
    Article Snippet: .. To generate CW79, the ecDHFR insert from pBMN DHFR(DD)-YFP (Wandless lab, Addgene #29325) was PCR amplified (primers 2561f/2562r) to add ClaI and SalI ends. ..

    Cloning:

    Article Title: Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation
    Article Snippet: .. Destabilized dCas9 activator was generated by PCR cloning the DHFR(DD) from pBMN DHFR(DD)-YFP (Addgene plasmid: 29352) and inserting it Nterminally in fusion with the dCas9 in the PB-CAG-dCas9VP192-GFP-IRES-Neo. ..

    Derivative Assay:

    Article Title: Selectable one-step PCR-mediated integration of a degron for rapid depletion of endogenous human proteins
    Article Snippet: .. Each gRNA was inserted into pX330 as described by Ran et al. ( 25 ). pAc5 HA3-eDHFR-T2A-puro was derived from pAc5gRNA Cas9 ( 26 ) by replacing the Eco RI- Hin dIII fragment encoding Cas9 with a PCR fragment encoding HA3-eDHFR amplified from pBMN DHFR(DD)-YFP ( 22 ) (Addgene plasmid #29325) with primers HA3-eDHFRfw and eDHFRrev (see Supplementary Material ). ..

    Amplification:

    Article Title: Selectable one-step PCR-mediated integration of a degron for rapid depletion of endogenous human proteins
    Article Snippet: .. Each gRNA was inserted into pX330 as described by Ran et al. ( 25 ). pAc5 HA3-eDHFR-T2A-puro was derived from pAc5gRNA Cas9 ( 26 ) by replacing the Eco RI- Hin dIII fragment encoding Cas9 with a PCR fragment encoding HA3-eDHFR amplified from pBMN DHFR(DD)-YFP ( 22 ) (Addgene plasmid #29325) with primers HA3-eDHFRfw and eDHFRrev (see Supplementary Material ). ..

    Article Title: Engineering receptors in the secretory pathway for orthogonal signalling control
    Article Snippet: .. The resulting PCR product was cloned EcoRI/HindIII into linearized pMMH37 by Gibson assembly. (PhPGK-SrcMS-TCS-tTA-pAbGH) This work pMMH202 Constitutive mammalian expression vector encoding PhPGK-driven ecDHFR(DD)-TCS-tTA expression. ecDHFR(DD) was PCR amplified from pBMN DHFR(DD)-YFP (Addgene no. 29325) using the primers: 5`- ggtatagggagaccgaattcatgatcagtctgattgcggcgttagcggtagattac and 5`- gttaatcactttacttttatctaatctggaactagttccacctccaccggactgaaagtacaggttttcaga tccacctccaccccgctccagaatctcaaagcaatagctgtgagagtt. ..

    Article Title: Achieving tight control of a photoactivatable Cre recombinase gene switch: new design strategies and functional characterization in mammalian cells and rodent
    Article Snippet: .. To generate CW79, the ecDHFR insert from pBMN DHFR(DD)-YFP (Wandless lab, Addgene #29325) was PCR amplified (primers 2561f/2562r) to add ClaI and SalI ends. ..

    Clone Assay:

    Article Title: Engineering receptors in the secretory pathway for orthogonal signalling control
    Article Snippet: .. The resulting PCR product was cloned EcoRI/HindIII into linearized pMMH37 by Gibson assembly. (PhPGK-SrcMS-TCS-tTA-pAbGH) This work pMMH202 Constitutive mammalian expression vector encoding PhPGK-driven ecDHFR(DD)-TCS-tTA expression. ecDHFR(DD) was PCR amplified from pBMN DHFR(DD)-YFP (Addgene no. 29325) using the primers: 5`- ggtatagggagaccgaattcatgatcagtctgattgcggcgttagcggtagattac and 5`- gttaatcactttacttttatctaatctggaactagttccacctccaccggactgaaagtacaggttttcaga tccacctccaccccgctccagaatctcaaagcaatagctgtgagagtt. ..

    Expressing:

    Article Title: Engineering receptors in the secretory pathway for orthogonal signalling control
    Article Snippet: .. The resulting PCR product was cloned EcoRI/HindIII into linearized pMMH37 by Gibson assembly. (PhPGK-SrcMS-TCS-tTA-pAbGH) This work pMMH202 Constitutive mammalian expression vector encoding PhPGK-driven ecDHFR(DD)-TCS-tTA expression. ecDHFR(DD) was PCR amplified from pBMN DHFR(DD)-YFP (Addgene no. 29325) using the primers: 5`- ggtatagggagaccgaattcatgatcagtctgattgcggcgttagcggtagattac and 5`- gttaatcactttacttttatctaatctggaactagttccacctccaccggactgaaagtacaggttttcaga tccacctccaccccgctccagaatctcaaagcaatagctgtgagagtt. ..

    Sequencing:

    Article Title: A drug-tunable Flt23k gene therapy for controlled intervention in retinal neovascularization.
    Article Snippet: .. The DHFR(DD) DNA sequence was based on pBMN-DHFR(DD)-YFP (a gift from Dr. Thomas Wandless at the Stanford University, USA; Addgene plasmid #29325). ..



    Similar Products

    94
    Addgene inc e coli dhfr
    E Coli Dhfr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+dhfr+dd+yfp/pBMN+YFP-DHFR(DD)+(Plasmid+%2329326)/pmc12802846-165-0-6
    Average 94 stars, based on 1 article reviews
    e coli dhfr - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Addgene inc pbmn yfp dhfr
    Pbmn Yfp Dhfr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+dhfr+dd+yfp/pBMN+YFP-DHFR(DD)+(Plasmid+%2329326)/bio_rxiv__2025__11__07__687321-120-11-13
    Average 94 stars, based on 1 article reviews
    pbmn yfp dhfr - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Addgene inc degron sequences dhfr dd
    Biochemical modulation of Aqp1 for background-subtracted imaging. (a) Percentage change in the diffusivities of CHO cells engineered to express ligand-activated Aqp1-DDs, following a 24 hour incubation with the respective ligand. Ligands include indole-3-acetic acid (IAA), dTAG-13, and shield-1 (shld1) which bind to degrons based on full-length (228 amino acids) and truncated (68 amino acids) forms of the plant protein, IAA17; the F36V mutant of the mammalian prolyl isomerase, FKBP12 (denoted as FK12 for brevity); and FKBP12 F36V modified to incorporate a 19-amino acid cryptic <t>degron</t> (denoted as FK12 (ref. )). (b) Percentage change in the diffusivities of CHO cells that have been engineered to express ligand-stabilized Aqp1-DDs, following a 24 hour incubation with the respective ligand. Ligands include 4-hydroxytamoxifen (4HT), trimethoprim (TMP), and shield-1, which bind to DDs based on the estrogen receptor ligand-binding domain (ER), e. coli dihydrofolate reductase (DH), and the F36V/L106P double mutant of FKBP12 (FK12). (c) Time-dependent increase in the diffusivity of Aqp1-FKBP12-DD transduced CHO and U87 cells upon exposure to shield-1. (d) Relative viability of cells following 24 hour incubation with 1 μM shield-1. (e) Percent change in the diffusivities of various cell lines engineered to express Aqp1-FKBP12-DD, following a 24 hour incubation with 1 μM shield-1. (f) Percent change in the diffusivities of cell lines engineered to express Aqp1 N-terminally fused to FKBP12-DD, following a 24 hour incubation with 1 μM shield-1. (g) Western blotting of cell extracts obtained from Aqp1-FKBP12-DD expressing CHO cells in the absence or presence of shield-1 treatment. Aqp1 was detected using antibodies targeting a FLAG epitope inserted at its N -terminus. The Na + /K + -ATPase pump (100 kDa) served as a loading control. (h) Immunofluorescence imaging of Aqp1-FKBP12-DD expressing CHO cells in the presence and absence of shield-1 treatment. Scale bar is 5 μm. Detection was performed using antibodies targeting a FLAG epitope inserted at the N -terminus of Aqp1. (i) Representative image of CHO cells expressing DD-free Aqp1 and Aqp1-FKBP12-DD that have undergone background subtraction. The difference image was produced by subtracting voxel-wise diffusion-weighted datasets (effective b -value ∼3 ms μm −2 ) acquired with and without shield-1 incubation, denoising the resulting image using a median filter, and displaying it as a pseudo colored “hotspot.” Error bars represent the standard deviation ( n ≥ 3). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.001, and n.s. is non-significant ( P ≥ 0.05). P -values were determined using unpaired, 2-sided t -test. For the time-series data, P -values were computed through one-way ANOVA followed by Tukey's HSD test.
    Degron Sequences Dhfr Dd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+dhfr+dd+yfp/pBMN+YFP-DHFR(DD)+(Plasmid+%2329326)/pmc11253201-148-4-8
    Average 94 stars, based on 1 article reviews
    degron sequences dhfr dd - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Addgene inc pbmn dhfr dd yfp 29325 83
    Biochemical modulation of Aqp1 for background-subtracted imaging. (a) Percentage change in the diffusivities of CHO cells engineered to express ligand-activated Aqp1-DDs, following a 24 hour incubation with the respective ligand. Ligands include indole-3-acetic acid (IAA), dTAG-13, and shield-1 (shld1) which bind to degrons based on full-length (228 amino acids) and truncated (68 amino acids) forms of the plant protein, IAA17; the F36V mutant of the mammalian prolyl isomerase, FKBP12 (denoted as FK12 for brevity); and FKBP12 F36V modified to incorporate a 19-amino acid cryptic <t>degron</t> (denoted as FK12 (ref. )). (b) Percentage change in the diffusivities of CHO cells that have been engineered to express ligand-stabilized Aqp1-DDs, following a 24 hour incubation with the respective ligand. Ligands include 4-hydroxytamoxifen (4HT), trimethoprim (TMP), and shield-1, which bind to DDs based on the estrogen receptor ligand-binding domain (ER), e. coli dihydrofolate reductase (DH), and the F36V/L106P double mutant of FKBP12 (FK12). (c) Time-dependent increase in the diffusivity of Aqp1-FKBP12-DD transduced CHO and U87 cells upon exposure to shield-1. (d) Relative viability of cells following 24 hour incubation with 1 μM shield-1. (e) Percent change in the diffusivities of various cell lines engineered to express Aqp1-FKBP12-DD, following a 24 hour incubation with 1 μM shield-1. (f) Percent change in the diffusivities of cell lines engineered to express Aqp1 N-terminally fused to FKBP12-DD, following a 24 hour incubation with 1 μM shield-1. (g) Western blotting of cell extracts obtained from Aqp1-FKBP12-DD expressing CHO cells in the absence or presence of shield-1 treatment. Aqp1 was detected using antibodies targeting a FLAG epitope inserted at its N -terminus. The Na + /K + -ATPase pump (100 kDa) served as a loading control. (h) Immunofluorescence imaging of Aqp1-FKBP12-DD expressing CHO cells in the presence and absence of shield-1 treatment. Scale bar is 5 μm. Detection was performed using antibodies targeting a FLAG epitope inserted at the N -terminus of Aqp1. (i) Representative image of CHO cells expressing DD-free Aqp1 and Aqp1-FKBP12-DD that have undergone background subtraction. The difference image was produced by subtracting voxel-wise diffusion-weighted datasets (effective b -value ∼3 ms μm −2 ) acquired with and without shield-1 incubation, denoising the resulting image using a median filter, and displaying it as a pseudo colored “hotspot.” Error bars represent the standard deviation ( n ≥ 3). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.001, and n.s. is non-significant ( P ≥ 0.05). P -values were determined using unpaired, 2-sided t -test. For the time-series data, P -values were computed through one-way ANOVA followed by Tukey's HSD test.
    Pbmn Dhfr Dd Yfp 29325 83, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+dhfr+dd+yfp/pBMN+DHFR(DD)-YFP+(Plasmid+%2329325)/pm37717069-251-25-21
    Average 93 stars, based on 1 article reviews
    pbmn dhfr dd yfp 29325 83 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    94
    Addgene inc degron sequences dhfr
    a , Fusing ligand-induced degradation (LID) tags to the C-terminus of Aqp1 generates modest changes in the diffusion coefficients of ligand-treated CHO cells relative to vehicle-treated controls. b , In contrast, fusing ligand-induced stabilization (LIS) tags to the C-terminus generates substantial changes in the diffusivities of ligand-treated CHO cells relative to controls. The largest response was observed in cells expressing Aqp1 fused to the FKBP12F36V/L106P <t>degron</t> (hereafter, the chimeric construct is referred to as LSAqp1), which was stabilized by a small-molecule, shield-1 (denoted as sh-1 in figures). c , Time-dependent increase in diffusion rate of LSAqp1-transduced cells following treatment with shield-1 (1 µM). d , Treatment of LSAqp1-transduced cells with shield-1 did not result in acute toxicity, as determined by MTT and ATP-based viability assays. e , Shield-1 modulation is specific to LSAqp1 and does not affect the baseline diffusivity of wild type cells or the enhanced diffusivity of red blood cells or cells engineered to express aquaporin-1. f , LSAqp1 permits small-molecule modulation of diffusivity in multiple cell types. g , Immunoblotting with anti-FLAG antibodies reveals a band of the expected size of LSAqp1 in membrane fractions extracted from shield-1 treated CHO cells (lane 2), which was only faintly observed in extracts obtained from vehicle-treated cells (lane 1). h , Confocal microscopy using anti-FLAG antibodies revealed membrane-localized LSAqp1 in shield-1 treated, but not vehicle-treated CHO cells. Images of both cells under both treatment conditions were acquired using identical optical settings (see Methods) and were displayed on the same color-scale. Scale bar is 5 µm. i , Background-free MRI with LSAqp1. Differential imaging was performed by voxel-wise subtraction of diffusion-weighted images acquired with and without shield-1 treatment. The ensuing image was denoised using a median filter and displayed as a pseudo-colored “hotspot”. Error bars represent the standard deviation ( n ≥ 3 biological replicates). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.005, and n.s. is non-significant ( P ≥ 0.05). P -values were computed based on 2-sided Student’s t-test (unpaired).
    Degron Sequences Dhfr, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+dhfr+dd+yfp/pBMN+YFP-DHFR(DD)+(Plasmid+%2329326)/bio_rxiv__2023__06__02__543364-123-4-8
    Average 94 stars, based on 1 article reviews
    degron sequences dhfr - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    93
    Addgene inc retroviral backbone
    a , Fusing ligand-induced degradation (LID) tags to the C-terminus of Aqp1 generates modest changes in the diffusion coefficients of ligand-treated CHO cells relative to vehicle-treated controls. b , In contrast, fusing ligand-induced stabilization (LIS) tags to the C-terminus generates substantial changes in the diffusivities of ligand-treated CHO cells relative to controls. The largest response was observed in cells expressing Aqp1 fused to the FKBP12F36V/L106P <t>degron</t> (hereafter, the chimeric construct is referred to as LSAqp1), which was stabilized by a small-molecule, shield-1 (denoted as sh-1 in figures). c , Time-dependent increase in diffusion rate of LSAqp1-transduced cells following treatment with shield-1 (1 µM). d , Treatment of LSAqp1-transduced cells with shield-1 did not result in acute toxicity, as determined by MTT and ATP-based viability assays. e , Shield-1 modulation is specific to LSAqp1 and does not affect the baseline diffusivity of wild type cells or the enhanced diffusivity of red blood cells or cells engineered to express aquaporin-1. f , LSAqp1 permits small-molecule modulation of diffusivity in multiple cell types. g , Immunoblotting with anti-FLAG antibodies reveals a band of the expected size of LSAqp1 in membrane fractions extracted from shield-1 treated CHO cells (lane 2), which was only faintly observed in extracts obtained from vehicle-treated cells (lane 1). h , Confocal microscopy using anti-FLAG antibodies revealed membrane-localized LSAqp1 in shield-1 treated, but not vehicle-treated CHO cells. Images of both cells under both treatment conditions were acquired using identical optical settings (see Methods) and were displayed on the same color-scale. Scale bar is 5 µm. i , Background-free MRI with LSAqp1. Differential imaging was performed by voxel-wise subtraction of diffusion-weighted images acquired with and without shield-1 treatment. The ensuing image was denoised using a median filter and displayed as a pseudo-colored “hotspot”. Error bars represent the standard deviation ( n ≥ 3 biological replicates). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.005, and n.s. is non-significant ( P ≥ 0.05). P -values were computed based on 2-sided Student’s t-test (unpaired).
    Retroviral Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+dhfr+dd+yfp/pBMN+DHFR(DD)-YFP+(Plasmid+%2329325)/bio_rxiv__2023__03__01__530713-168-27-30
    Average 93 stars, based on 1 article reviews
    retroviral backbone - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pbmn dhfr dd mvenus
    a , Fusing ligand-induced degradation (LID) tags to the C-terminus of Aqp1 generates modest changes in the diffusion coefficients of ligand-treated CHO cells relative to vehicle-treated controls. b , In contrast, fusing ligand-induced stabilization (LIS) tags to the C-terminus generates substantial changes in the diffusivities of ligand-treated CHO cells relative to controls. The largest response was observed in cells expressing Aqp1 fused to the FKBP12F36V/L106P <t>degron</t> (hereafter, the chimeric construct is referred to as LSAqp1), which was stabilized by a small-molecule, shield-1 (denoted as sh-1 in figures). c , Time-dependent increase in diffusion rate of LSAqp1-transduced cells following treatment with shield-1 (1 µM). d , Treatment of LSAqp1-transduced cells with shield-1 did not result in acute toxicity, as determined by MTT and ATP-based viability assays. e , Shield-1 modulation is specific to LSAqp1 and does not affect the baseline diffusivity of wild type cells or the enhanced diffusivity of red blood cells or cells engineered to express aquaporin-1. f , LSAqp1 permits small-molecule modulation of diffusivity in multiple cell types. g , Immunoblotting with anti-FLAG antibodies reveals a band of the expected size of LSAqp1 in membrane fractions extracted from shield-1 treated CHO cells (lane 2), which was only faintly observed in extracts obtained from vehicle-treated cells (lane 1). h , Confocal microscopy using anti-FLAG antibodies revealed membrane-localized LSAqp1 in shield-1 treated, but not vehicle-treated CHO cells. Images of both cells under both treatment conditions were acquired using identical optical settings (see Methods) and were displayed on the same color-scale. Scale bar is 5 µm. i , Background-free MRI with LSAqp1. Differential imaging was performed by voxel-wise subtraction of diffusion-weighted images acquired with and without shield-1 treatment. The ensuing image was denoised using a median filter and displayed as a pseudo-colored “hotspot”. Error bars represent the standard deviation ( n ≥ 3 biological replicates). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.005, and n.s. is non-significant ( P ≥ 0.05). P -values were computed based on 2-sided Student’s t-test (unpaired).
    Pbmn Dhfr Dd Mvenus, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+dhfr+dd+yfp/pBMN+DHFR(DD)-YFP+(Plasmid+%2329325)/bio_rxiv__2023__03__01__530713-168-25-30
    Average 93 stars, based on 1 article reviews
    pbmn dhfr dd mvenus - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc c737303 plv dd ires turborfp
    a , Fusing ligand-induced degradation (LID) tags to the C-terminus of Aqp1 generates modest changes in the diffusion coefficients of ligand-treated CHO cells relative to vehicle-treated controls. b , In contrast, fusing ligand-induced stabilization (LIS) tags to the C-terminus generates substantial changes in the diffusivities of ligand-treated CHO cells relative to controls. The largest response was observed in cells expressing Aqp1 fused to the FKBP12F36V/L106P <t>degron</t> (hereafter, the chimeric construct is referred to as LSAqp1), which was stabilized by a small-molecule, shield-1 (denoted as sh-1 in figures). c , Time-dependent increase in diffusion rate of LSAqp1-transduced cells following treatment with shield-1 (1 µM). d , Treatment of LSAqp1-transduced cells with shield-1 did not result in acute toxicity, as determined by MTT and ATP-based viability assays. e , Shield-1 modulation is specific to LSAqp1 and does not affect the baseline diffusivity of wild type cells or the enhanced diffusivity of red blood cells or cells engineered to express aquaporin-1. f , LSAqp1 permits small-molecule modulation of diffusivity in multiple cell types. g , Immunoblotting with anti-FLAG antibodies reveals a band of the expected size of LSAqp1 in membrane fractions extracted from shield-1 treated CHO cells (lane 2), which was only faintly observed in extracts obtained from vehicle-treated cells (lane 1). h , Confocal microscopy using anti-FLAG antibodies revealed membrane-localized LSAqp1 in shield-1 treated, but not vehicle-treated CHO cells. Images of both cells under both treatment conditions were acquired using identical optical settings (see Methods) and were displayed on the same color-scale. Scale bar is 5 µm. i , Background-free MRI with LSAqp1. Differential imaging was performed by voxel-wise subtraction of diffusion-weighted images acquired with and without shield-1 treatment. The ensuing image was denoised using a median filter and displayed as a pseudo-colored “hotspot”. Error bars represent the standard deviation ( n ≥ 3 biological replicates). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.005, and n.s. is non-significant ( P ≥ 0.05). P -values were computed based on 2-sided Student’s t-test (unpaired).
    C737303 Plv Dd Ires Turborfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+dhfr+dd+yfp/pBMN+DHFR(DD)-YFP+(Plasmid+%2329325)/pm36641749-568-116-127
    Average 93 stars, based on 1 article reviews
    c737303 plv dd ires turborfp - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Biochemical modulation of Aqp1 for background-subtracted imaging. (a) Percentage change in the diffusivities of CHO cells engineered to express ligand-activated Aqp1-DDs, following a 24 hour incubation with the respective ligand. Ligands include indole-3-acetic acid (IAA), dTAG-13, and shield-1 (shld1) which bind to degrons based on full-length (228 amino acids) and truncated (68 amino acids) forms of the plant protein, IAA17; the F36V mutant of the mammalian prolyl isomerase, FKBP12 (denoted as FK12 for brevity); and FKBP12 F36V modified to incorporate a 19-amino acid cryptic degron (denoted as FK12 (ref. )). (b) Percentage change in the diffusivities of CHO cells that have been engineered to express ligand-stabilized Aqp1-DDs, following a 24 hour incubation with the respective ligand. Ligands include 4-hydroxytamoxifen (4HT), trimethoprim (TMP), and shield-1, which bind to DDs based on the estrogen receptor ligand-binding domain (ER), e. coli dihydrofolate reductase (DH), and the F36V/L106P double mutant of FKBP12 (FK12). (c) Time-dependent increase in the diffusivity of Aqp1-FKBP12-DD transduced CHO and U87 cells upon exposure to shield-1. (d) Relative viability of cells following 24 hour incubation with 1 μM shield-1. (e) Percent change in the diffusivities of various cell lines engineered to express Aqp1-FKBP12-DD, following a 24 hour incubation with 1 μM shield-1. (f) Percent change in the diffusivities of cell lines engineered to express Aqp1 N-terminally fused to FKBP12-DD, following a 24 hour incubation with 1 μM shield-1. (g) Western blotting of cell extracts obtained from Aqp1-FKBP12-DD expressing CHO cells in the absence or presence of shield-1 treatment. Aqp1 was detected using antibodies targeting a FLAG epitope inserted at its N -terminus. The Na + /K + -ATPase pump (100 kDa) served as a loading control. (h) Immunofluorescence imaging of Aqp1-FKBP12-DD expressing CHO cells in the presence and absence of shield-1 treatment. Scale bar is 5 μm. Detection was performed using antibodies targeting a FLAG epitope inserted at the N -terminus of Aqp1. (i) Representative image of CHO cells expressing DD-free Aqp1 and Aqp1-FKBP12-DD that have undergone background subtraction. The difference image was produced by subtracting voxel-wise diffusion-weighted datasets (effective b -value ∼3 ms μm −2 ) acquired with and without shield-1 incubation, denoising the resulting image using a median filter, and displaying it as a pseudo colored “hotspot.” Error bars represent the standard deviation ( n ≥ 3). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.001, and n.s. is non-significant ( P ≥ 0.05). P -values were determined using unpaired, 2-sided t -test. For the time-series data, P -values were computed through one-way ANOVA followed by Tukey's HSD test.

    Journal: Chemical Science

    Article Title: Destabilized reporters for background-subtracted, chemically-gated, and multiplexed deep-tissue imaging

    doi: 10.1039/d4sc00377b

    Figure Lengend Snippet: Biochemical modulation of Aqp1 for background-subtracted imaging. (a) Percentage change in the diffusivities of CHO cells engineered to express ligand-activated Aqp1-DDs, following a 24 hour incubation with the respective ligand. Ligands include indole-3-acetic acid (IAA), dTAG-13, and shield-1 (shld1) which bind to degrons based on full-length (228 amino acids) and truncated (68 amino acids) forms of the plant protein, IAA17; the F36V mutant of the mammalian prolyl isomerase, FKBP12 (denoted as FK12 for brevity); and FKBP12 F36V modified to incorporate a 19-amino acid cryptic degron (denoted as FK12 (ref. )). (b) Percentage change in the diffusivities of CHO cells that have been engineered to express ligand-stabilized Aqp1-DDs, following a 24 hour incubation with the respective ligand. Ligands include 4-hydroxytamoxifen (4HT), trimethoprim (TMP), and shield-1, which bind to DDs based on the estrogen receptor ligand-binding domain (ER), e. coli dihydrofolate reductase (DH), and the F36V/L106P double mutant of FKBP12 (FK12). (c) Time-dependent increase in the diffusivity of Aqp1-FKBP12-DD transduced CHO and U87 cells upon exposure to shield-1. (d) Relative viability of cells following 24 hour incubation with 1 μM shield-1. (e) Percent change in the diffusivities of various cell lines engineered to express Aqp1-FKBP12-DD, following a 24 hour incubation with 1 μM shield-1. (f) Percent change in the diffusivities of cell lines engineered to express Aqp1 N-terminally fused to FKBP12-DD, following a 24 hour incubation with 1 μM shield-1. (g) Western blotting of cell extracts obtained from Aqp1-FKBP12-DD expressing CHO cells in the absence or presence of shield-1 treatment. Aqp1 was detected using antibodies targeting a FLAG epitope inserted at its N -terminus. The Na + /K + -ATPase pump (100 kDa) served as a loading control. (h) Immunofluorescence imaging of Aqp1-FKBP12-DD expressing CHO cells in the presence and absence of shield-1 treatment. Scale bar is 5 μm. Detection was performed using antibodies targeting a FLAG epitope inserted at the N -terminus of Aqp1. (i) Representative image of CHO cells expressing DD-free Aqp1 and Aqp1-FKBP12-DD that have undergone background subtraction. The difference image was produced by subtracting voxel-wise diffusion-weighted datasets (effective b -value ∼3 ms μm −2 ) acquired with and without shield-1 incubation, denoising the resulting image using a median filter, and displaying it as a pseudo colored “hotspot.” Error bars represent the standard deviation ( n ≥ 3). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.001, and n.s. is non-significant ( P ≥ 0.05). P -values were determined using unpaired, 2-sided t -test. For the time-series data, P -values were computed through one-way ANOVA followed by Tukey's HSD test.

    Article Snippet: Plasmids harboring the various degron sequences – DHFR-DD (Addgene 29326), ER-DD (Addgene 37261), miniIAA7 (Addgene 129721), and FKBP12 (Addgene 17416) were amplified using Q5 High-Fidelity 2× Master Mix and cloned by Gibson assembly in a lentiviral transfer vector at the C or N -terminus of the aquaporin-1 reporter (Aqp1) under the control of either a constitutive promoter, EF1α (Addgene 60058) or a doxycycline-inducible minimal CMV promoter (Addgene 26431).

    Techniques: Imaging, Incubation, Mutagenesis, Modification, Ligand Binding Assay, Western Blot, Expressing, FLAG-tag, Control, Immunofluorescence, Produced, Diffusion-based Assay, Standard Deviation

    a , Fusing ligand-induced degradation (LID) tags to the C-terminus of Aqp1 generates modest changes in the diffusion coefficients of ligand-treated CHO cells relative to vehicle-treated controls. b , In contrast, fusing ligand-induced stabilization (LIS) tags to the C-terminus generates substantial changes in the diffusivities of ligand-treated CHO cells relative to controls. The largest response was observed in cells expressing Aqp1 fused to the FKBP12F36V/L106P degron (hereafter, the chimeric construct is referred to as LSAqp1), which was stabilized by a small-molecule, shield-1 (denoted as sh-1 in figures). c , Time-dependent increase in diffusion rate of LSAqp1-transduced cells following treatment with shield-1 (1 µM). d , Treatment of LSAqp1-transduced cells with shield-1 did not result in acute toxicity, as determined by MTT and ATP-based viability assays. e , Shield-1 modulation is specific to LSAqp1 and does not affect the baseline diffusivity of wild type cells or the enhanced diffusivity of red blood cells or cells engineered to express aquaporin-1. f , LSAqp1 permits small-molecule modulation of diffusivity in multiple cell types. g , Immunoblotting with anti-FLAG antibodies reveals a band of the expected size of LSAqp1 in membrane fractions extracted from shield-1 treated CHO cells (lane 2), which was only faintly observed in extracts obtained from vehicle-treated cells (lane 1). h , Confocal microscopy using anti-FLAG antibodies revealed membrane-localized LSAqp1 in shield-1 treated, but not vehicle-treated CHO cells. Images of both cells under both treatment conditions were acquired using identical optical settings (see Methods) and were displayed on the same color-scale. Scale bar is 5 µm. i , Background-free MRI with LSAqp1. Differential imaging was performed by voxel-wise subtraction of diffusion-weighted images acquired with and without shield-1 treatment. The ensuing image was denoised using a median filter and displayed as a pseudo-colored “hotspot”. Error bars represent the standard deviation ( n ≥ 3 biological replicates). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.005, and n.s. is non-significant ( P ≥ 0.05). P -values were computed based on 2-sided Student’s t-test (unpaired).

    Journal: bioRxiv

    Article Title: Engineering ligand stabilized aquaporin reporters for magnetic resonance imaging

    doi: 10.1101/2023.06.02.543364

    Figure Lengend Snippet: a , Fusing ligand-induced degradation (LID) tags to the C-terminus of Aqp1 generates modest changes in the diffusion coefficients of ligand-treated CHO cells relative to vehicle-treated controls. b , In contrast, fusing ligand-induced stabilization (LIS) tags to the C-terminus generates substantial changes in the diffusivities of ligand-treated CHO cells relative to controls. The largest response was observed in cells expressing Aqp1 fused to the FKBP12F36V/L106P degron (hereafter, the chimeric construct is referred to as LSAqp1), which was stabilized by a small-molecule, shield-1 (denoted as sh-1 in figures). c , Time-dependent increase in diffusion rate of LSAqp1-transduced cells following treatment with shield-1 (1 µM). d , Treatment of LSAqp1-transduced cells with shield-1 did not result in acute toxicity, as determined by MTT and ATP-based viability assays. e , Shield-1 modulation is specific to LSAqp1 and does not affect the baseline diffusivity of wild type cells or the enhanced diffusivity of red blood cells or cells engineered to express aquaporin-1. f , LSAqp1 permits small-molecule modulation of diffusivity in multiple cell types. g , Immunoblotting with anti-FLAG antibodies reveals a band of the expected size of LSAqp1 in membrane fractions extracted from shield-1 treated CHO cells (lane 2), which was only faintly observed in extracts obtained from vehicle-treated cells (lane 1). h , Confocal microscopy using anti-FLAG antibodies revealed membrane-localized LSAqp1 in shield-1 treated, but not vehicle-treated CHO cells. Images of both cells under both treatment conditions were acquired using identical optical settings (see Methods) and were displayed on the same color-scale. Scale bar is 5 µm. i , Background-free MRI with LSAqp1. Differential imaging was performed by voxel-wise subtraction of diffusion-weighted images acquired with and without shield-1 treatment. The ensuing image was denoised using a median filter and displayed as a pseudo-colored “hotspot”. Error bars represent the standard deviation ( n ≥ 3 biological replicates). * denotes P < 0.05, ** denotes P < 0.01, *** denotes P < 0.005, and n.s. is non-significant ( P ≥ 0.05). P -values were computed based on 2-sided Student’s t-test (unpaired).

    Article Snippet: Plasmids harboring the various degron sequences - DHFR (Addgene 29326), ER (Addgene 37261), miniIAA7 (Addgene 129721), SMASh (Addgene 68853), and FKBP12 (Addgene 17416) were amplified using Q5 High-Fidelity 2X Master Mix and cloned by Gibson assembly in a lentiviral transfer vector at the C or N-terminus of the aquaporin-1 reporter (Aqp1) under the control of either a constitutive promoter, EF1α (Addgene 60058) or a doxycycline-inducible minimal CMV promoter (Addgene 26431).

    Techniques: Diffusion-based Assay, Expressing, Construct, Western Blot, Membrane, Confocal Microscopy, Imaging, Standard Deviation

    a , LSAqp1 (responsive to shield-1, sh-1), Aq-dhfr (stabilized by trimethoprim, TMP), and Aq-ER (responsive to 4-hydroxytamoxifen, HT) are mutually orthogonal, because treatment with non-cognate ligands does not increase the diffusion coefficients of CHO cells transduced with the respective reporter construct. b , Ligand-dependent increase in diffusion (relative to vehicle-treated cells) in a mixed population comprising equal numbers of LSAqp1- and Aq-dhfr transduced cells. Ligand addition permits the stepwise modulation of diffusivity by stabilizing one or both degron-tagged Aqp1 constructs. c , Components of the mixed-cell population were resolved by differential imaging. Subtraction of diffusion-weighted images of untreated cells from images acquired after treatment with shield-1 reveals the LSAqp1 population. Likewise, subtracting diffusion-weighted images of shield-1 treated cells from those obtained after treatment with shield-1 and TMP revealed the Aq-dhfr population. The images were denoised by median filtering and pseudo-colored to distinguish the LSAqp1- and Aq-dhfr-expressing sub-populations. d , Ligand-dependent increase in the diffusion coefficient of a mixed population comprising U87 and Jurkat cells transduced respectively with LSAqp1 and Aq-ER. As before, ligand addition permits the stepwise modulation of diffusion. e , The two cell types can be distinguished by differential imaging after sequential treatment with ligands. The images were denoised by median filtering and pseudo-colored to distinguish between the two cell-types. Error bars represent standard deviation ( n ≥ 4 biological replicates).

    Journal: bioRxiv

    Article Title: Engineering ligand stabilized aquaporin reporters for magnetic resonance imaging

    doi: 10.1101/2023.06.02.543364

    Figure Lengend Snippet: a , LSAqp1 (responsive to shield-1, sh-1), Aq-dhfr (stabilized by trimethoprim, TMP), and Aq-ER (responsive to 4-hydroxytamoxifen, HT) are mutually orthogonal, because treatment with non-cognate ligands does not increase the diffusion coefficients of CHO cells transduced with the respective reporter construct. b , Ligand-dependent increase in diffusion (relative to vehicle-treated cells) in a mixed population comprising equal numbers of LSAqp1- and Aq-dhfr transduced cells. Ligand addition permits the stepwise modulation of diffusivity by stabilizing one or both degron-tagged Aqp1 constructs. c , Components of the mixed-cell population were resolved by differential imaging. Subtraction of diffusion-weighted images of untreated cells from images acquired after treatment with shield-1 reveals the LSAqp1 population. Likewise, subtracting diffusion-weighted images of shield-1 treated cells from those obtained after treatment with shield-1 and TMP revealed the Aq-dhfr population. The images were denoised by median filtering and pseudo-colored to distinguish the LSAqp1- and Aq-dhfr-expressing sub-populations. d , Ligand-dependent increase in the diffusion coefficient of a mixed population comprising U87 and Jurkat cells transduced respectively with LSAqp1 and Aq-ER. As before, ligand addition permits the stepwise modulation of diffusion. e , The two cell types can be distinguished by differential imaging after sequential treatment with ligands. The images were denoised by median filtering and pseudo-colored to distinguish between the two cell-types. Error bars represent standard deviation ( n ≥ 4 biological replicates).

    Article Snippet: Plasmids harboring the various degron sequences - DHFR (Addgene 29326), ER (Addgene 37261), miniIAA7 (Addgene 129721), SMASh (Addgene 68853), and FKBP12 (Addgene 17416) were amplified using Q5 High-Fidelity 2X Master Mix and cloned by Gibson assembly in a lentiviral transfer vector at the C or N-terminus of the aquaporin-1 reporter (Aqp1) under the control of either a constitutive promoter, EF1α (Addgene 60058) or a doxycycline-inducible minimal CMV promoter (Addgene 26431).

    Techniques: Diffusion-based Assay, Transduction, Construct, Imaging, Expressing, Standard Deviation